• Users Online: 538
  • Print this page
  • Email this page


 
 
Table of Contents
ORIGINAL ARTICLE
Year : 2019  |  Volume : 16  |  Issue : 2  |  Page : 156-162

Molecular characteristics and clinical relevance of cytotoxin-associated genes A and E of Helicobacter pylori from Patients with gastric diseases


1 Department of Microbiology, College of Medicine, Al-Nahrain University, Baghdad, Iraq
2 Medical Research Unit, College of Medicine, Al-Nahrain University, Baghdad, Iraq
3 Gastrointestinal Tract and Liver Diseases Teaching Hospital, Baghdad, Iraq
4 Department of Physiology, College of Medicine, Al-Nahrain University, Baghdad, Iraq

Date of Web Publication17-Jun-2019

Correspondence Address:
Ahmed L Hamad
Department of Microbiology, College of Medicine, Al-Nahrain University, Baghdad
Iraq
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/MJBL.MJBL_19_19

Get Permissions

  Abstract 


Background: Helicobacter pylori colonizes about a half of the world's population. It possesses several genes that associated with virulence, among which are cytotoxin-associated antigen (CagA) and cytotoxin-associated gene E (CagE) genes within the cag pathogenicity island. These genes encode for proteins involved in the pathogenicity of the bacteria. Objective: This study aimed to investigate the prevalence of CagA and CagE genes among H. pylori isolates from patients with different gastric pathologies and for phylogenetic analysis of the isolated bacteria according to gene sequence. Materials and Methods: A total of 104 gastric biopsies were collected for patients suffering from different gastric pathologies. DNA was extracted from these biopsies, and a conventional polymerase chain reaction (PCR) was performed to amplify the gene fragments corresponding CagA and CagE genes using specific primers. PCR product of selected samples of positive for CagE was undergone direct sequencing. The result of sequences was aligned with reference sequences in National Center for Biotechnology Information (NCBI), and the phylogenetic tree was constructed. Results: Out of 104 isolates of H. pylori, 89/104 (85.58%) were found to have either CagA, CagE, or both genes. The frequencies of CagA, CagE, and coexistence of both genes were 71.15%, 46.15%, and 31.73%, respectively. The phylogenetic tree revealed two main clades, one of which involved isolates 6 and 9 as separated isolates and another clade involved all other isolates. The isolate 4 clustered with AY153111.1 and AP014523.1, the isolate 3 clustered with AY153124.1, the isolate 5 clustered with LC339073.1 and LC339017.1, the isolates 7 and 11 clustered with EU090726.1, the isolate 2 clustered with AB191082.1, the isolate 10 clustered very close to LC339004.1 and less close to LS483488.1, while the isolate 1 clustered with AP017334.1. Conclusion: CagA and CagE genes are highly prevalence among H. pylori isolate from gastric pathologies from Iraqi patients.

Keywords: Cytotoxin-associated antigen, cytotoxin-associated gene E, Helicobacter pylori, phylogenetic analysis


How to cite this article:
Hamad AL, Shamran HA, Al-Maliki JM, Mahmood IA. Molecular characteristics and clinical relevance of cytotoxin-associated genes A and E of Helicobacter pylori from Patients with gastric diseases. Med J Babylon 2019;16:156-62

How to cite this URL:
Hamad AL, Shamran HA, Al-Maliki JM, Mahmood IA. Molecular characteristics and clinical relevance of cytotoxin-associated genes A and E of Helicobacter pylori from Patients with gastric diseases. Med J Babylon [serial online] 2019 [cited 2019 Aug 24];16:156-62. Available from: http://www.medjbabylon.org/text.asp?2019/16/2/156/260467




  Introduction Top


Helicobacter pylori, a spiral, Gram-negative, microaerophilic bacterium, colonizes at least half of the world's population and is recognized as a major cause of chronic gastritis (CG) and peptic ulcer disease (PUD) and as an important risk factor for gastric cancer (GC).[1] On the basis of various epidemiological studies, H. pylori was classified as a Class I carcinogen in humans by a working group of the World Health Organization International Agency for Research on Cancer.[2] Infection rates vary among the developed and developing countries of the world. H. pylori infection is on a steep decline in most of the western countries mainly due to the success of combination therapies and improved personal hygiene and community sanitation to prevent reinfection. However, the situation is not improving in many of the developing countries due to failure of treatment regimens and emergence of drug resistance.[3]

One of the most distinctive features of H. pylori is the genetic diversity between clinical isolates obtained from different patient populations. Most H. pylori isolates can be discriminated from each other by DNA profiling [4] or sequencing of certain genes mainly due to a high degree of sequence divergence between orthologs (3%–5%).[5]

H. pylori infection is usually acquired during childhood, where transmission occurs predominantly within families.[4] A couple of recent studies demonstrated the possible coexistence of a large array of clonal lineages within H. pylori populations that are evolving in each individual separately from one another.[5] It is, therefore, probable that through this semi-vertical transmission of H. pylori strains, there are distinct sets of H. pylori genotypes colonizing different human populations. With different strains evolving separately of one another and the fact that H. pylori is a genetically diverse organism, distinct genotypes have been found to be associated with particular geographic regions.[6] The cytotoxin-associated antigen (CagA) gene of H. pylori was assumed as partially responsible for eliciting signaling mechanisms that lead to the development of gastric pathologies. Based on the carriage of a functional CagA as a marker for the cag pathogenicity island (cag PAI), the H. pylori species is divided into CagA-positive and CagA-negative strains. The CagA-positive strains were thought to be associated with higher grades of gastric or duodenal ulceration and are more virulent than the CagA-negative strains;[7] however, such assumption was not confirmed. Furthermore, some epidemiological studies have demonstrated the roles of CagA-positive H. pylori in the development of atrophic gastritis, PUD, and GC.[8]

Cytotoxin-associated gene E (CagE) is one of the marker genes in cag1 of the cag PAI. It is essential for CagA translocation and phosphorylation.[9] Some reports indicated that the presence of the CagE gene has been associated with a bad clinical outcome, especially in developed countries.[10]

In Iraq, there is no previous study of phylogenetic analysis of H. pylori. Therefore, the current study aimed to investigate the prevalence of CagA and CagE genes among H. pylori isolates from patients with different gastric pathologies and for phylogenetic analysis of the isolated bacteria according to gene sequence.


  Materials And Methods Top


Patients and samples

This is a cross-sectional study including a total of 104 patients suffering from gastric diseases, who underwent esophagogastroduodenoscopy (EGD) and examination at Gastrointestinal Tract and Liver Diseases Institute, Baghdad, from December 2017 to September 2018. Two gastric tissue biopsies were obtained from the antral part of the stomach during gastrointestinal endoscopy. The first one was sent to a histopathological laboratory while the second was placed in 1 ml of normal saline and preserved at −20°C for molecular analysis.

Histopathology examination results were taken from patient record. According to these results, patients were grouped to CG, acute gastritis (AG), and gastric ulcer (GU).

DNA was extracted from these biopsies using a commercial ready kit (The Wizard ® Genomic DNA Purification Kit/Promega).

The present study was approved by the Ethical Committee of the College of Medicine/Al-Nahrain University.

Measurement of extracted DNA concentration and purity

A NanoDrop (UVS-99/ACT Gene/USA) was used to evaluate the concentration and purity of the extracted DNA.

Conventional polymerase chain reaction to detect Helicobacter pylori

Conventional polymerase chain reaction (PCR) was performed to amplify the gene fragments corresponding CagA (350 bp) and CagE (508 bp) genes using specific primers CagA forward (GATAACAGGCAA GCTTTTTGAGG) and reverse (CTGCAAAAG ATTGTTTGGCAG) and CagE forward (TTGAAAACTTCAAGGATAGGATAGAGC) and reverse (GCCTAGCGTAATATCACC ATTACCC).[11],[12] GoTaq ® Green Master Mix is a premixed ready-to-use solution containing bacterially derived Taq DNA polymerase, deoxynucleoside triphosphates, MgCl2, and reaction buffers at optimal concentrations for efficient amplification of DNA templates by PCR. Four microliters of template DNA and 2 μl of each primer (forward and reverse) were added to the master mix tube. The final volume was adjusted to 50 μl with free nuclease distal water. The mixture was then centrifuged for 10 s and put in thermocycler (Hybaid/UK) which was previously programmed with the following conditions: 94°C, 5 min one cycle (94°C, 30 s and 46°C, 30 s and 72°C, 30 s 40 cycles) 72°C, 10 min one cycle.

DNA sequencing

The PCR products of CagE gene were directly sequenced using Big Dye terminator method (Macrogen/Korea). The obtained sequences were aligned with normal sequence from GenBank.

Statistical analysis

The Statistical Package for the Social Sciences version 25 (SPSS, IBM, Chicago/USA) was used for all statistical analyses. Continuous variables were expressed as mean ± standard deviation and analyzed with ANOVA. Binomial variables were expressed as frequency and percentage and analyzed with Chi-square. Phylogenic relevance between local isolates and reference isolates and within local isolates was calculated using Mega 7 software/ Pennsylvania State University/USA with 1000 bootstrap replicates. P < 0.05 was considered statistically significant.


  Results Top


Clinical characteristics and frequencies of different gastric diseases

This study included a total of 104 patients who underwent EGD and found to be H. pylori positive. Three major categories of gastric illness were represented in those patients based on histopathological examination. These categories were CG (49, 47.11%), AG (49, 47.11%), and GU (49, 47.11%), as shown in [Figure 1].
Figure 1: Frequencies of gastric clinical characteristics

Click here to view


Molecular assay

Cytotoxin-associated antigen gene gel electrophoresis

Gel electrophoresis of PCR product for CagA gene is presented in [Figure 2]. The PCR product was 350 bp.
Figure 2: Gel electrophoresis of polymerase chain reaction product for cytotoxin-associated antigen gene. Molecular ladder (M), lanes (1, 2, 3, 5, 6, and 7) are positive for cytotoxin-associated antigen gene with fragment length of 350 bp, lanes 4 and 8 are negative for cytotoxin-associated antigen gene

Click here to view


Cytotoxin-associated Antigen gel electrophoresis

Gel electrophoresis of PCR product for CagE gene is presented in [Figure 3]. The PCR product was 508 bp.
Figure 3: Gel electrophoresis of polymerase chain reaction product for cytotoxin-associated gene E. Molecular ladder (M), lanes (1, 2, 3, 5, 7, 8, 9, and 10) are positive for cytotoxin-associated gene E with fragment length of 508 bp, lanes 4 and 6 are negative for cytotoxin-associated gene E

Click here to view


Prevalence of cytotoxin-associated antigen, cytotoxin -associated gene E, or both genes in Helicobacter pylori from patients with gastric illnesses

Out of 104 isolates of H. pylori, 89/104 (85.58%) were found to have either CagA, CagE, or both genes. The frequencies of each gene among the total isolates were 74/104 (71.15%) for CagA, 48/104 (46.15%) for CagE, and 33/104 (31.73%) for both genes.

Genetic analysis of Helicobacter pylori

Alignment of Helicobacter pylori sequences with reference sequences

The PCR products from 11 samples of H. pylori positive were sent abroad to Macrogen Company in South Korea for direct sequencing. As CagE gene is a protein-coding gene, the nucleotide sequences of this gene were translated into the corresponding amino acid using EMBOSS Transeq available online at https://www.ebi.ac.uk/Tools/st/emboss_transeq/. As well, the ten reference isolates were AP017334.1, AB191082.1, AY153111.1, AP014523.1, AY153124.1, LC339073.1, LS483488.1, LC339017.1, EU090726.1, and LC339004.1, translated by this program. BioEdit software, version 6 (Carlsbad/ CA, USA) was used to align and compare the different amino acid sequences between local isolates and reference sequences [Figure 4] and [Figure 5].
Figure 4: Alignment of 11 Helicobacter pylori local isolates with 1 reference isolate from GeneBank (indicated by its accession number) using BioEdit software

Click here to view
Figure 5: Alignment of 11 Helicobacter pylori local isolates with 1 reference isolate from GeneBank (indicated by its accession number) using BioEdit software

Click here to view


The nucleotide sequences of this gene were translated into the corresponding amino acid using EMBOSS Transeq.

Phylogenetic tree

Furthermore, the genetic relatedness of the local isolates to the selected reference isolates was analyzed with Mega 7 software (Pennsylvania State University/USA) through the construction of phylogenetic tree [Figure 6]. The phylogenetic tree revealed two main clades, one of which involved isolates 6 and 9 as separated isolates and another clade involved all other isolates, as well as the reference isolates, isolate 8 although clustered within the other isolates; however, it had no closest reference isolates. The local isolate 4 clustered with AY153111.1 and AP014523.1, the isolate 3 clustered with AY153124.1, the isolate 5 clustered with LC339073.1 and LC339017.1, the isolates 7 and 11 clustered with EU090726.1, the isolate 2 clustered with AB191082.1, the isolate 10 clustered very close to LC339004.1 and less close to LS483488.1, while the isolate 1 clustered with AP017334.1.
Figure 6: Phylogenetic tree for cytotoxin-associated gene E constructed by the 11 local isolates from gastric tissue biopsies and 10 reference isolates from GeneBank. Model of the tree was statistically supported by bootstrapping with 1000 replicates. Bootstrap values below 30% are not shown. Current isolates are indicated with green square

Click here to view



  Discussion Top


The CagA, as a marker for the presence of the cag PAI, is one of the best-studied virulence factors for H. pylori, and the frequency of CagA-positive isolates has been reported as 74% in the current study. Globally, CagA gene was reported in about 25%-60% of H. pylori isolates in Bahrain and Jordan, and 60%-80% in other countries such as Taiwan, Malaysia, and India.[13] According to a study, the CagA-positive genotype varied geographically from 44% to 94% in Iranian populations.[13] On the other hand, in a study from Turkey, Erdoǧdu et al. reported a CagA positivity rate of 65.5%.[14]

The prevalence of CagA-positive strains of H. pylori differs in various parts of the world.[15] For example, Kadi et al.[16] reported a prevalence rate of 81.7%, while in Tunisia,[17] Egypt,[15] Palestine [18] and Iran,[19] the prevalence rates of the CagA gene were 61.6%, 65.2%, 65.9%, and 68.7%, respectively. In Russia, Cyprus [20],[21],[22] and East to South Asian countries,[1],[23],[24] the reported prevalence was 85%, 42.5%, and 90%, respectively.

In another study in Brazil, the frequency of CagE gene was 53.2%, and most of the H. pylori strains CagA positive were associated with CagE positive (62.3%).[25]

CagE was found more commonly in patients with GC than in the other patient groups (93.8%; 15/16). The combination of the CagA and CagE genes was detected in 87.5% (98/112) of the patients.[23]

In another study in the USA, the CagE gene, also within the PAI and shown to stimulate the production of several cytokines from infected epithelial cells, was found in 62% of with H. pylori and in 95% of CagA-positive H. pylori, where all CagE-positive H. pylori were also CagA positive.[18]

The presence of the CagE gene was also reported to vary in different geographic regions and/or ethnic groups (e.g., 64% in the US, 71% in the UK, 70% in Malaysia, 88% in Thailand, 28% in Turkey, and 77% in India).[1],[23],[26],[27],[28],[29] The prevalence of the CagE gene in studied isolates from both countries was close to each other (51% in Iranian vs. 53% in Afghani isolates), and different with other countries, another finding was different with a very limited report on only three Afghani samples.[30]

Frequencies of different gastric diseases of patients who underwent EGD were 104 and they were found to be H. pylori positive and classified into three major categories of gastric illness were recognized based on histopathological examination. The categories were CG (49, 47.11%), AG (49, 47.11%), and GU (6, 5.7%).

Compared to other studies, more than 90% of people infected with H. pylori experienced varying degrees of gastritis, with moderate gastritis (51.10%) having the highest incidence.[31] In the study conducted by Hashemi et al. in southern Iran (2006), 70% of people infected with H. pylori suffered from CG, and in another study in Saudi Arabia, this rate was 60%.[32],[33]

A study was also showed that there was a direct relationship between the severity of H. pylori infection and the degree of CG. Hence, if the level of colonization was mild, the chance of severe CG among the participants was only 0.57% while this chance was about 28% among those with severe colonization.[31]

In a study conducted by Ardakani and Mohammadizadeh in Isfahan on 272 samples of gastric biopsy, there was no relationship between the density and volume of H. pylori and the severity of CG activity.[34] In a study by Yakoob and Hussainy in Pakistan, there was a relationship between the intensity of H. pylori colonization and CG activity.[35]

The findings of the study showed that there was a dose–response relationship between H. pylori colonization and gastritis such that in mild colonization, only 20.63% of the samples had severe gastritis, while in intense colonization of H. pylori, 43.75% of the samples had severe gastritis.[31] In a study by Alagoz et al. in Turkey (2002), it was shown that there was a relationship between the level of colonization and gastritis.[36]

This relationship was not found in the study conducted by Park et al. in Korea, which could be due to the genetic differences, nutritional habits, and environmental factors between the two study populations.[37]

Most isolates (2–5, 7, 8, and 11) differed only in two amino acids, while 1 and 10 isolates differed in only one amino acid, which the majority of nucleotide variations of isolates (1–5, 7, 8, 10, and 11) were synonymous. The only exception are isolates 6 and 9 which they had 19 and 22 substitutions, respectively. Furthermore, the two isolates differed between each other which may indicate the presence of new alleles for CagE gene and reflects the genetic diversity of the gene among different isolates of H. pylori.

Phylogenetic analysis revealed the wide diversity of Iraqi isolates of H. pylori. Unfortunately, there is no local reference isolate registered in NCBI. Therefore, the results of the sequences were compared with international isolates. Three of local isolates (3, 5, and 10) had clustered with an Indonesian isolate, while other three of local isolates (4, 2, and 1) had clustered with a Japanese isolate, and other two of local isolates (11 and 7) had clustered with a Chinese isolate. The phylogenetic tree revealed two main clades, one of which involved isolates 6 and 9 as separated isolates and another clade involved all other isolates, as well as the reference isolates, isolate 8 although clustered within the other isolates; however, it had no closest reference isolates.

The vast majority of the isolates in the current study had closed with Asian isolates (three with an Indonesian isolate, three with a Japanese isolate, and two with a Chinese isolate). This indicates the importance of modern communications and transporting in bacterial transfer between different countries. However, it is worthy to mention that none of the local isolates were identical to any of the reference isolate which implies a unique molecular structure of the local isolate.

Furthermore, the local isolate 4 also had closed clustering to a Spanish isolate (AY153111.1). On the other hand, the isolate 10 had less close of clustering to the United Kingdom isolate (LS483488.1), which reflects the high levels of reciprocal travels between Iraq and other European countries (Spanish and United Kingdom).


  Conclusion Top


From this study it can conclude that a highly prevalence of CagA and CagE genes is recorded among H. pylori isolates recovered from gastric pathologies from Iraqi patients.

Financial support and sponsorship

Nil.

Conflicts of interest

There are no conflicts of interest.



 
  References Top

1.
Tan HJ, Rizal AM, Rosmadi MY, Goh KL. Distribution of Helicobacter pylori cagA, cagE and vacA in different ethnic groups in Kuala Lumpur, Malaysia. J Gastroenterol Hepatol 2005;20:589-94.  Back to cited text no. 1
    
2.
Uemura N, Okamoto S, Yamamoto S, Matsumura N, Yamaguchi S, Yamakido M, et al. Helicobacter pylori infection and the development of gastric cancer. N Engl J Med 2001;345:784-9.  Back to cited text no. 2
    
3.
van Belkum A. High-throughput epidemiologic typing in clinical microbiology. Clin Microbiol Infect 2003;9:86-100.  Back to cited text no. 3
    
4.
Ahmed N, Sechi LA. Helicobacter pylori and gastroduodenal pathology: New threats of the old friend. Ann Clin Microbiol Antimicrob 2005;4:1.  Back to cited text no. 4
    
5.
Owen RJ, Xerry J. Tracing clonality of Helicobacter pylori infecting family members from analysis of DNA sequences of three housekeeping genes (ureI, atpA and ahpC), deduced amino acid sequences, and pathogenicity-associated markers (cagA and vacA). J Med Microbiol 2003;52:515-24.  Back to cited text no. 5
    
6.
Kersulyte D, Mukhopadhyay AK, Velapatiño B, Su W, Pan Z, Garcia C, et al. Differences in genotypes of Helicobacter pylor i from different human populations. J Bacteriol 2000;182:3210-8.  Back to cited text no. 6
    
7.
Kuipers EJ, Pérez-Pérez GI, Meuwissen SG, Blaser MJ. Helicobacter pylori and atrophic gastritis: Importance of the cagA status. J Natl Cancer Inst 1995;87:1777-80.  Back to cited text no. 7
    
8.
Parsonnet J, Friedman GD, Orentreich N, Vogelman H. Risk for gastric cancer in people with cagA positive or cagA negative Helicobacter pylori infection. Gut 1997;40:297-301.  Back to cited text no. 8
    
9.
Odenbreit S, Püls J, Sedlmaier B, Gerland E, Fischer W, Haas R. Translocation of Helicobacter pylori cagA into gastric epithelial cells by type IV secretion. Science 2000;287:1497-500.  Back to cited text no. 9
    
10.
Fallone CA, Beech R, Barkun A, Gottke M, Loo V, Nguyen T. The Helicobacter pylori vacA S1 genotype and the cagE gene are associated with gastroduodenal disease. Gastroenterology 1998;114:A117.  Back to cited text no. 10
    
11.
Boonyanugomol W, Chomvarin C, Sripa B, Chau-In S, Pugkhem A, Namwat W, et al. Molecular analysis of Helicobacter pylori virulent-associated genes in hepatobiliary patients. HPB (Oxford) 2012;14:754-63.  Back to cited text no. 11
    
12.
Salih BA, Bolek BK, Yildiz MT, Arikan S. Phylogenetic analysis of Helicobacter pylori cagA gene of Turkish isolates and the association with gastric pathology. Gut Pathog 2013;5:33.  Back to cited text no. 12
    
13.
Mukhopadhyay AK, Kersulyte D, Jeong JY, Datta S, Ito Y, Chowdhury A, et al. Distinctiveness of genotypes of Helicobacter pylori in Calcutta, India. J Bacteriol 2000;182:3219-27.  Back to cited text no. 13
    
14.
Erdoǧdu C, Saribaş Z, Akyön Yilmaz Y. Detection of cagA and vacA genotypes of Helicobacter pylori isolates from a university hospital in Ankara region, Turkey. Turk J Med Sci 2014;44:126-32.  Back to cited text no. 14
    
15.
Amer FA, El-Sokkary RH, Elahmady M, Gheith T, Hassan Abdelbary E, Elnagar Y, et al. Helicobacter pylori genotypes among patients in a university hospital in Egypt: Identifying the determinants of disease severity. J Microbiol Infec Dis 2013;3:109-15.  Back to cited text no. 15
    
16.
Nayar DS. Current eradication rate of Helicobacter pylori with clarithromycin-based triple therapy in a gastroenterology practice in the New York metropolitan area. Infect Drug Resist 2018;11:205-11.  Back to cited text no. 16
    
17.
Ben Mansour K, Fendri C, Zribi M, Masmoudi A, Labbene M, Fillali A, et al. Prevalence of Helicobacter pylori vacA, cagA, iceA and oipA genotypes in Tunisian patients. Ann Clin Microbiol Antimicrob 2010;9:10.  Back to cited text no. 17
    
18.
Essawi T, Hammoudeh W, Sabri I, Sweidan W, Farraj MA. Determination of Helicobacter pylori virulence genes in gastric biopsies by PCR. ISRN Gastroenterol 2013;2013:606258.  Back to cited text no. 18
    
19.
Ghotaslou R, Milani M, Akhi MT, Nahaei MR, Hasani A, Hejazi MS, et al. Diversity of Helicobacter pylori cagA and vacA genes and its relationship with clinical outcomes in Azerbaijan, Iran. Adv Pharm Bull 2013;3:57-62.  Back to cited text no. 19
    
20.
Hussein NR. Helicobacter pylori and gastric cancer in the Middle East: A new enigma? World J Gastroenterol 2010;16:3226-34.  Back to cited text no. 20
    
21.
Krashias G, Bashiardes S, Potamitou A, Potamitis GS, Christodoulou C. Prevalence of Helicobacter pylori cagA and vacA genes in cypriot patients. J Infect Dev Ctries 2013;7:642-50.  Back to cited text no. 21
    
22.
Saribasak H, Salih BA, Yamaoka Y, Sander E. Analysis of Helicobacter pylori genotypes and correlation with clinical outcome in Turkey. J Clin Microbiol 2004;42:1648-51.  Back to cited text no. 22
    
23.
Chomvarin C, Namwat W, Chaicumpar K, Mairiang P, Sangchan A, Sripa B, et al. Prevalence of Helicobacter pylori vacA, cagA, cagE, iceA and babA2 genotypes in Thai dyspeptic patients. Int J Infect Dis 2008;12:30-6.  Back to cited text no. 23
    
24.
Datta S, Chattopadhyay S, Balakrish Nair G, Mukhopadhyay AK, Hembram J, Berg DE, et al. Virulence genes and neutral DNA markers of Helicobacter pylori isolates from different ethnic communities of West Bengal, India. J Clin Microbiol 2003;41:3737-43.  Back to cited text no. 24
    
25.
Lima VP, Silva-Fernandes IJ, Alves MK, Rabenhorst SH. Prevalence of Helicobacter pylori genotypes (vacA, cagA, cagE and virB11) in gastric cancer in Brazilian's patients: An association with histopathological parameters. Cancer Epidemiol 2011;35:e32-7.  Back to cited text no. 25
    
26.
Podzorski RP, Podzorski DS, Wuerth A, Tolia V. Analysis of the vacA, cagA, cagE, iceA, and babA2 genes in Helicobacter pylori from sixty-one pediatric patients from the Midwestern United States. Diagn Microbiol Infect Dis 2003;46:83-8.  Back to cited text no. 26
    
27.
Kauser F, Hussain MA, Ahmed I, Ahmad N, Habeeb A, Khan AA, et al. Comparing genomes of Helicobacter pylori strains from the high-altitude desert of Ladakh, India. J Clin Microbiol 2005;43:1538-45.  Back to cited text no. 27
    
28.
Tiwari SK, Khan AA, Ahmed KS, Ali SM, Ahmed I, Habeeb A, et al. Polymerase chain reaction based analysis of the cytotoxin associated gene pathogenicity Island of Helicobacter pylori from saliva: An approach for rapid molecular genotyping in relation to disease status. J Gastroenterol Hepatol 2005;20:1560-6.  Back to cited text no. 28
    
29.
Salih BA, Abasiyanik MF, Ahmed N. A preliminary study on the genetic profile of cag pathogenicity-Island and other virulent gene loci of Helicobacter pylori strains from Turkey. Infect Genet Evol 2007;7:509-12.  Back to cited text no. 29
    
30.
Dabiri H, Maleknejad P, Yamaoka Y, Feizabadi MM, Jafari F, Rezadehbashi M, et al. Distribution of Helicobacter pylori cagA, cagE, oipA and vacA in different major ethnic groups in Tehran, Iran. J Gastroenterol Hepatol 2009;24:1380-6.  Back to cited text no. 30
    
31.
Ghasemi Basir HR, Ghobakhlou M, Akbari P, Dehghan A, Seif Rabiei MA. Correlation between the intensity of Helicobacter pylori colonization and severity of gastritis. Gastroenterol Res Pract 2017;2017:8320496.  Back to cited text no. 31
    
32.
Hashemi MR, Rahnavardi M, Bikdeli B, Dehghani Zahedani M. H pylori infection among 1000 Southern Iranian dyspeptic patients. World J Gastroenterol 2006;12:5479-82.  Back to cited text no. 32
    
33.
Ayoola AE, Ageely HM, Gadour MO, Pathak VP. Prevalence of Helicobacter pylori infection among patients with dyspepsia in South-Western Saudi Arabia. Saudi Med J 2004;25:1433-8.  Back to cited text no. 33
    
34.
Ardakani A, Mohammadizadeh F. The study of relationship between Helicobacter pylori density in gastric mucosa and the severity and activity of chronic gastritis. J Res Med Sci 2006;11:282.  Back to cited text no. 34
    
35.
Yakoob MY, Hussainy AS. Chronic gastritis and Helicobacter pylori: A histopathological study of gastric mucosal biopsies. J Coll Physicians Surg Pak 2010;20:773-5.  Back to cited text no. 35
    
36.
Alagöz S, Türkay C, Yönem O. The relationship between Helicobacter pylori intensity and histopathological findings in cases with chronic gastritis and duodenal ulcer. Turk J Gastroenterol 2002;13:98-102.  Back to cited text no. 36
    
37.
Park J, Kim MK, Park SM. Influence of Helicobacter pylori colonization on histological grading of chronic gastritis in Korean patients with peptic ulcer. Korean J Intern Med 1995;10:125-9.  Back to cited text no. 37
    


    Figures

  [Figure 1], [Figure 2], [Figure 3], [Figure 4], [Figure 5], [Figure 6]



 

Top
 
  Search
 
    Similar in PUBMED
   Search Pubmed for
   Search in Google Scholar for
 Related articles
    Access Statistics
    Email Alert *
    Add to My List *
* Registration required (free)  

 
  In this article
Abstract
Introduction
Materials And Me...
Results
Discussion
Conclusion
References
Article Figures

 Article Access Statistics
    Viewed120    
    Printed19    
    Emailed0    
    PDF Downloaded23    
    Comments [Add]    

Recommend this journal